• Question: in my last question you said that you use lots of really powerful computers to help you with your work, so what are they and what would you use them specifically for?

    Asked by heisenberg to Debbie, Glyn, Jon, Kat, Nicola on 13 Mar 2013.
    • Photo: Jonathan Stone

      Jonathan Stone answered on 13 Mar 2013:

      I use some pretty powerful computing to combine lots aerial photographs together to form a map. This is sort of like how they make the aerial photographs for google earth/google maps…but on a much finer scale. Once we have the images, we can do some cool visualisation things with them. There are some really powerful computers at the British Geological Survey (one of my employers) for this: http://www.bgs.ac.uk/research/technologies_epo.html

    • Photo: Kathryn McMahon

      Kathryn McMahon answered on 13 Mar 2013:

      We have powerful computers to help us look at tumours. You’d have to ask our computing guys what they are – you need a specialist computer scientist to run them! We have fancy software for taking photographs of slices of tumours, which we can zoom in on and even make into 3D images. We use them to get a better look at the tumours and doctors use them to decide what the cancer is and which drugs to give. It takes up a lot of memory, we have big machines just for the storage space. You can have a look at some of the photos here – they have lots of pictures of different cancers:

      http://www.virtualpathology.leeds.ac.uk/public/

    • Photo: Debbie Crockard

      Debbie Crockard answered on 13 Mar 2013:

      In my last job we used lots of high definition video and images so the computer isn’t hugely powerful but it had a HUGE amount of storage!

    • Photo: Nicola Fletcher

      Nicola Fletcher answered on 13 Mar 2013:

      I use quite powerful computers to to work out the DNA sequence of viruses that are in the brain, liver and blood of people. Also I take lots of photos and movies of viruses infecting cells and we need pretty big computers to store all of those results.

    • Photo: Glyn Barrett

      Glyn Barrett answered on 13 Mar 2013:

      We use really powerful computers to find differences in DNA sequences.
      If you can imagine that a DNA sequence is a really really long word made up of only 4 letters (A T G and C). One of the words/DNA sequences I work with is nearly 6 million letters long (that’s quite small in comparison to what other scientists work with though!).
      So a really small example could be like for example AGGTTACCGTTAGGTATCCTAGGAGATTATATGGAGACCACACTATT etc… but instead the word I am working with contains 6 million of them!!!! its Mad!!

      anyways I work in genetics and sometimes a mistake happens when the word is copied so for example an A may turn into a G or a T. Can you imagine trying to find a one mistake like that amongst 6 million!! A needle in a haystack is nothing in comparison 🙂

      So I use really powerful computers to find out where these mistakes have happened.

      (if you were interested in supercomputers you should check this website out http://www.networkworld.com/community/blog/japanese-supercomputer-blisters-10-quadrillio
      Its a Japanese computer which can do 10 quadrillion calculations a second!!! that’s 10,000,000,000,000,000 calculations per second!!! argh painful!)

Comments